ID: 905028318_905028328

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 905028318 905028328
Species Human (GRCh38) Human (GRCh38)
Location 1:34865882-34865904 1:34865897-34865919
Sequence CCCCCTGCCCAGCCCGGGCGCCT GGGCGCCTTCGCGTGGGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 65, 4: 611} {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!