ID: 905035119_905035130

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 905035119 905035130
Species Human (GRCh38) Human (GRCh38)
Location 1:34913085-34913107 1:34913120-34913142
Sequence CCAAGGGAAATCACCTCCTTTTC CAGAAAATGGAGAAGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 275} {0: 1, 1: 1, 2: 17, 3: 148, 4: 1316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!