ID: 905035981_905035985

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 905035981 905035985
Species Human (GRCh38) Human (GRCh38)
Location 1:34918593-34918615 1:34918636-34918658
Sequence CCGATTGGCTGAAAAGTGGGTCA GAGAAAATGGAGAAGTAGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97} {0: 1, 1: 0, 2: 0, 3: 52, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!