ID: 905044449_905044458

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 905044449 905044458
Species Human (GRCh38) Human (GRCh38)
Location 1:34985033-34985055 1:34985076-34985098
Sequence CCCCAGGCAGGACCTGCGCCTCA CCCCAGCTCCAGCTGAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 211} {0: 1, 1: 0, 2: 6, 3: 66, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!