ID: 905166331_905166338

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 905166331 905166338
Species Human (GRCh38) Human (GRCh38)
Location 1:36085279-36085301 1:36085295-36085317
Sequence CCTGACACAGGCAGGGATCCAGG ATCCAGGACTGGGTGCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 281} {0: 1, 1: 0, 2: 0, 3: 16, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!