ID: 905168789_905168799

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 905168789 905168799
Species Human (GRCh38) Human (GRCh38)
Location 1:36098374-36098396 1:36098401-36098423
Sequence CCAGGGCGACCCGTGAAACCCGG CCCTTGGGCCCAGTTGGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140} {0: 1, 1: 1, 2: 1, 3: 95, 4: 981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!