ID: 905168936_905168945

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 905168936 905168945
Species Human (GRCh38) Human (GRCh38)
Location 1:36098757-36098779 1:36098779-36098801
Sequence CCCAGGGGGGCCCCGGGTCCCTG GGCTCCCCTTTGGCCCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 275} {0: 1, 1: 0, 2: 1, 3: 29, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!