ID: 905169195_905169206

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 905169195 905169206
Species Human (GRCh38) Human (GRCh38)
Location 1:36099406-36099428 1:36099423-36099445
Sequence CCAGGGGGACCCCGAGGCCCGGG CCCGGGCTTCCCAGGGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 49, 4: 437} {0: 1, 1: 0, 2: 2, 3: 35, 4: 562}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!