ID: 905183502_905183508

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 905183502 905183508
Species Human (GRCh38) Human (GRCh38)
Location 1:36180233-36180255 1:36180251-36180273
Sequence CCTGTTTTTCCCCAGAAGTCCTT TCCTTTAAGAGGGTTTGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 391} {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!