ID: 905202131_905202144

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 905202131 905202144
Species Human (GRCh38) Human (GRCh38)
Location 1:36322543-36322565 1:36322576-36322598
Sequence CCTCCTCGTCCTCGTCGTCGTCC GGGTGCTGCTGCGGGGGTCCCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 36, 3: 277, 4: 4487} {0: 1, 1: 0, 2: 4, 3: 40, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!