ID: 905225175_905225180

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 905225175 905225180
Species Human (GRCh38) Human (GRCh38)
Location 1:36474011-36474033 1:36474028-36474050
Sequence CCTGTCTCCAGGCAGAGTGGCTC TGGCTCTGGAAGGGCAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 579} {0: 1, 1: 0, 2: 8, 3: 40, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!