ID: 905225175_905225187

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 905225175 905225187
Species Human (GRCh38) Human (GRCh38)
Location 1:36474011-36474033 1:36474056-36474078
Sequence CCTGTCTCCAGGCAGAGTGGCTC GCTAAGTTGCAGGCATGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 579} {0: 1, 1: 0, 2: 0, 3: 8, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!