ID: 905225942_905225948

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 905225942 905225948
Species Human (GRCh38) Human (GRCh38)
Location 1:36479294-36479316 1:36479324-36479346
Sequence CCCACATCTGTGGCTCAGACTTG TGGGATTCTCTGGGAATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 247} {0: 1, 1: 0, 2: 2, 3: 13, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!