ID: 905254563_905254570

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 905254563 905254570
Species Human (GRCh38) Human (GRCh38)
Location 1:36671863-36671885 1:36671907-36671929
Sequence CCAGTCATGCTCTGCAGACAACC AGATCAAAGTCATCAGATGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!