ID: 905277387_905277389

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 905277387 905277389
Species Human (GRCh38) Human (GRCh38)
Location 1:36827309-36827331 1:36827356-36827378
Sequence CCCTGGGGCTTCTGTGGATATTT ATCACTTCCCTTCCTCAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 208} {0: 1, 1: 0, 2: 2, 3: 12, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!