ID: 905284778_905284788

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 905284778 905284788
Species Human (GRCh38) Human (GRCh38)
Location 1:36872143-36872165 1:36872181-36872203
Sequence CCAGCAGACCCCAGTCATCTGTC CACGCACCTGCTTGAGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 201} {0: 1, 1: 0, 2: 0, 3: 3, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!