ID: 905293339_905293345

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 905293339 905293345
Species Human (GRCh38) Human (GRCh38)
Location 1:36938377-36938399 1:36938426-36938448
Sequence CCAAAGTTGAATGACCACATAGC AACCTTGACCTGCTACTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96} {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!