ID: 905307730_905307737

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 905307730 905307737
Species Human (GRCh38) Human (GRCh38)
Location 1:37031013-37031035 1:37031035-37031057
Sequence CCTGGAAATTCAGGTCCCCACGG GGAGGTCACTGAAGCCCGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99} {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!