ID: 905329369_905329373

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 905329369 905329373
Species Human (GRCh38) Human (GRCh38)
Location 1:37181577-37181599 1:37181599-37181621
Sequence CCTCTTTGGGGCTCCCCTGGGGA AGTTATAAACAAAATGTATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!