ID: 905345033_905345040

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 905345033 905345040
Species Human (GRCh38) Human (GRCh38)
Location 1:37305643-37305665 1:37305668-37305690
Sequence CCCAGCACCTTTCCTACGCCTGG AGCCCCAGCCCAGCCCCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 16, 3: 123, 4: 884}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!