ID: 905352147_905352150

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 905352147 905352150
Species Human (GRCh38) Human (GRCh38)
Location 1:37355239-37355261 1:37355289-37355311
Sequence CCAGGGTGGAGGAATCTATACCC GTGCAGTACATGTTTATAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!