ID: 905356599_905356608

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 905356599 905356608
Species Human (GRCh38) Human (GRCh38)
Location 1:37389187-37389209 1:37389211-37389233
Sequence CCAGAAGGTGCATATCCAGACCT GTGGCAACAGTGGGGCTGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 40, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!