ID: 905369191_905369198

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 905369191 905369198
Species Human (GRCh38) Human (GRCh38)
Location 1:37474380-37474402 1:37474394-37474416
Sequence CCCGCTTGGGCCCCGTCCGGCGC GTCCGGCGCGCAGCGGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96} {0: 1, 1: 0, 2: 1, 3: 21, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!