ID: 905390969_905390972

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 905390969 905390972
Species Human (GRCh38) Human (GRCh38)
Location 1:37635017-37635039 1:37635031-37635053
Sequence CCTTGCCCGAAGCTGGCGCTCTG GGCGCTCTGCGCTCCGAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131} {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!