ID: 905390970_905390977

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 905390970 905390977
Species Human (GRCh38) Human (GRCh38)
Location 1:37635022-37635044 1:37635043-37635065
Sequence CCCGAAGCTGGCGCTCTGCGCTC TCCGAGCGCGGGGCTGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105} {0: 1, 1: 0, 2: 2, 3: 24, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!