ID: 905397264_905397277

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 905397264 905397277
Species Human (GRCh38) Human (GRCh38)
Location 1:37674758-37674780 1:37674803-37674825
Sequence CCCCTGCACCATTTCTACCACTT GAGCCCCTTGCTGAGCTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 252} {0: 1, 1: 0, 2: 0, 3: 15, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!