ID: 905397265_905397278

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 905397265 905397278
Species Human (GRCh38) Human (GRCh38)
Location 1:37674759-37674781 1:37674804-37674826
Sequence CCCTGCACCATTTCTACCACTTG AGCCCCTTGCTGAGCTGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!