ID: 905397266_905397277

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 905397266 905397277
Species Human (GRCh38) Human (GRCh38)
Location 1:37674760-37674782 1:37674803-37674825
Sequence CCTGCACCATTTCTACCACTTGG GAGCCCCTTGCTGAGCTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!