ID: 905426694_905426702

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 905426694 905426702
Species Human (GRCh38) Human (GRCh38)
Location 1:37891257-37891279 1:37891310-37891332
Sequence CCAGCTACCCTGGGACAACTTAC GGAGAACCTCAGTCCTACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 94} {0: 1, 1: 1, 2: 1, 3: 19, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!