ID: 905449118_905449129

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 905449118 905449129
Species Human (GRCh38) Human (GRCh38)
Location 1:38046040-38046062 1:38046092-38046114
Sequence CCCGCGCCCGGGTGCAGGTGCGC CATGTCCGTGTGCGTGTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 134} {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!