ID: 905485375_905485382

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 905485375 905485382
Species Human (GRCh38) Human (GRCh38)
Location 1:38292408-38292430 1:38292421-38292443
Sequence CCCCCAGGCTCCCCACCGGCCCG CACCGGCCCGCTGCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 379} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!