ID: 905485726_905485727

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 905485726 905485727
Species Human (GRCh38) Human (GRCh38)
Location 1:38294847-38294869 1:38294860-38294882
Sequence CCAAGATGGTGTCTTGAATGCCA TTGAATGCCATATGCTCCAGAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 4, 3: 44, 4: 223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!