|
Left Crispr |
Right Crispr |
| Crispr ID |
905493383 |
905493391 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:38362881-38362903
|
1:38362924-38362946
|
| Sequence |
CCTTCCACTGGGTCCCTCTCATG |
CTACAATTCAAGATGAGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|