ID: 905493389_905493392

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 905493389 905493392
Species Human (GRCh38) Human (GRCh38)
Location 1:38362895-38362917 1:38362925-38362947
Sequence CCTCTCATGACACATGGGGATTA TACAATTCAAGATGAGATTTGGG
Strand - +
Off-target summary {0: 44, 1: 582, 2: 1729, 3: 3340, 4: 5391} {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!