ID: 905553018_905553040

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 905553018 905553040
Species Human (GRCh38) Human (GRCh38)
Location 1:38859325-38859347 1:38859364-38859386
Sequence CCGGCCGCCGCCCTCCCGGGCGT CTGAGAACCGGGGAGGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 476} {0: 1, 1: 0, 2: 3, 3: 62, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!