ID: 905591241_905591245

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 905591241 905591245
Species Human (GRCh38) Human (GRCh38)
Location 1:39165959-39165981 1:39166001-39166023
Sequence CCTTCCTTTCATTGAGAACTTTC TTGATAGTCCCTGTCTTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 458} {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!