ID: 905591242_905591245

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 905591242 905591245
Species Human (GRCh38) Human (GRCh38)
Location 1:39165963-39165985 1:39166001-39166023
Sequence CCTTTCATTGAGAACTTTCTGAC TTGATAGTCCCTGTCTTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 201} {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!