ID: 905596814_905596824

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 905596814 905596824
Species Human (GRCh38) Human (GRCh38)
Location 1:39214690-39214712 1:39214738-39214760
Sequence CCTTTTGGCAGCTGTAAGTGCGG AGGGATCTGTTCACAGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65} {0: 1, 1: 0, 2: 0, 3: 11, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!