ID: 905625928_905625943

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 905625928 905625943
Species Human (GRCh38) Human (GRCh38)
Location 1:39490937-39490959 1:39490990-39491012
Sequence CCAGAGCTTCTGGCCCAGCTGGA GGATCAGTACCGGGGACGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!