ID: 905651180_905651188

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 905651180 905651188
Species Human (GRCh38) Human (GRCh38)
Location 1:39658032-39658054 1:39658065-39658087
Sequence CCATGCTCTGTCCCGTTCCCCAC GCTCAACAGGATGCAATAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 442} {0: 1, 1: 0, 2: 2, 3: 8, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!