ID: 905663039_905663041

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 905663039 905663041
Species Human (GRCh38) Human (GRCh38)
Location 1:39743059-39743081 1:39743074-39743096
Sequence CCCACAGGTGGCTTTGGGGTGGC GGGGTGGCTGCATAGCTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 37, 4: 211} {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!