ID: 905673458_905673474

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 905673458 905673474
Species Human (GRCh38) Human (GRCh38)
Location 1:39808304-39808326 1:39808341-39808363
Sequence CCCGTCTGCCAAGTGAGGAGCCC TGCCCCGTCCAGGAGGTGGGGGG
Strand - +
Off-target summary No data {0: 9, 1: 81, 2: 499, 3: 2943, 4: 6125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!