ID: 905693620_905693629

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 905693620 905693629
Species Human (GRCh38) Human (GRCh38)
Location 1:39959983-39960005 1:39960011-39960033
Sequence CCTTCAGGGTGGCTCCTGGCAGA GGATGGGGTAATACCCGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257} {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!