ID: 905753542_905753544

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 905753542 905753544
Species Human (GRCh38) Human (GRCh38)
Location 1:40487221-40487243 1:40487241-40487263
Sequence CCTACAGTTGATTCTTGAGCAGC AGCGCAGGTTTGAACTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137} {0: 2, 1: 1, 2: 34, 3: 139, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!