ID: 905779102_905779112

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 905779102 905779112
Species Human (GRCh38) Human (GRCh38)
Location 1:40692082-40692104 1:40692100-40692122
Sequence CCCGCGGGCTTTCTCCCATTGGC TTGGCGGAAGGCGACGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 84} {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!