ID: 905819695_905819703

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 905819695 905819703
Species Human (GRCh38) Human (GRCh38)
Location 1:40979905-40979927 1:40979932-40979954
Sequence CCGAATAGCCCCGCCGCCGCGGT GACGTCGCTCCTACCAATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26} {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!