ID: 905833931_905833933

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 905833931 905833933
Species Human (GRCh38) Human (GRCh38)
Location 1:41100232-41100254 1:41100261-41100283
Sequence CCCGGGTATGGTGATAAAAGAGA AAAGCACTTTCCACTTAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183} {0: 1, 1: 0, 2: 0, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!