|
Left Crispr |
Right Crispr |
| Crispr ID |
905834406 |
905834410 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:41105043-41105065
|
1:41105069-41105091
|
| Sequence |
CCTCCTGGGTTCAAGTGATTCTC |
CTTCAATATCCGAAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 21628, 1: 64917, 2: 122797, 3: 157734, 4: 166761} |
{0: 1, 1: 0, 2: 35, 3: 1053, 4: 18351} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|