ID: 905846815_905846832

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 905846815 905846832
Species Human (GRCh38) Human (GRCh38)
Location 1:41241346-41241368 1:41241392-41241414
Sequence CCCCAGGGCCGCTGTGGCTCACT CCCGTTTCCGGCGGGGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 196} {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!