ID: 905862527_905862548

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 905862527 905862548
Species Human (GRCh38) Human (GRCh38)
Location 1:41361156-41361178 1:41361203-41361225
Sequence CCGCGGACCAATGGGAGTGTTAG CTCCGCGCCGAGCAGGGGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!